Member Since June 22, 2008
Liked this profile? Tell your friends about it

Recent Activity by Leigh

Answered: Name of N. C. Troops

Lawrence O'Bryan Branch's North Carolina brigade.

Asked: Nomos vs physis

why is nomos vs physis an ethical issue

Asked: Prostate cancer

why do men with prostate cancer have trouble urinating

Asked: Left ventricle

where does left ventricle empty

Asked: 2012 olympics

how do we get tickets and accomodations for the 2012 olympics in London????????????????

Asked: Mutation and gene flow

how do mutation and gene flow work against each other

Asked: Alleles

How can alleles be produced?

Asked: Biology

how to produce new alleles

Asked: Protein synthesis

what peptide will the following mRNA sequence code be for if it were attached to a ribosome in a cell? (don't forget about start and stop codons) 5' AUGUUACUGUCGAGUCGUAGAUAAAAAA 3'

Topics of Interest

Leigh did not provide topics yet.

Contacts

Leigh has no contacts.

Compliments

No compliments were posted on Leigh's profile yet.